Sequence Viewer for Students
Educational software for viewing and comparing DNA sequences
1. Introduction.
An understanding of genetic diversity at the DNA sequence level is important in many areas of biology. There are many computer programs available for analzing DNA sequences. However, most of them are too complex for introductory biology students to use. Sequence Viewer for Students is a user-friendly program designed for college Freshman or Sophmores. It enables students to view DNA sequences and count the number of differences between them.
A partial screen shot is show below.

In the picture above, "." indicates that the nucleotide is the same as the top sequence (human). (Note that even in this short sequence, the genetic similarity between humans and chimpanzees is readily evident.)
2. Installation.
Download the files here to obtain Sequence Viewer for Students and a sample data file. Sequence Viewer runs on the Windows operating system, and requires the .NET framework to be installed. The .NET Framework is a component of the Microsoft Windows operating system used to build and run Windows-based applications. If you have a recent version of Windows, you probably already have .NET installed on your computer. You can check by clicking Start on your Windows desktop, selecting Control Panel, and then double-clicking the Add or Remove Programs icon. When that window appears, scroll through the list of applications. If you see Microsoft .NET Framework 2.0 listed, the latest version is already installed and you do not need to install it again.
If you do not have .NET already installed on your computer, the easiest way to install it is to update your operating system. This is relatively painless. To begin, open Microsoft Explorer, select Tools --> Windows Update, find Microsoft .NET framework 2.0 and install it (It will be listed under "Pick updates to install").
To “install” SequenceViewer download the file SequenceViewer.exe. Click on the SequenceViewer.exe file to run. To “uninstall,” simply delete the file.
3. Input files.
SequenceViewer reads genetic data from text files in a specfic format. Two sample input files are included with the program, and the format of the file should be self explanatory. Each data file contains a list of aligned DNA sequences of equal length It is important that the sequences are aligned). The sample below illustrates the format.
TITLE: Primate NADH sequences
#human
ATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTA
ATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTT
#chimpanzee
ACACCCATGACCAACCTCCTACTCCTCATTGTACCCATCCTAATCGCAATAGCATTCCTA
ATGCTAACCGAACGAAAAATTCTAGGCTACATACAACTACGCAAAGGTCCCAACATT
#gorilla
ATATCCATGGCTAACCTTCTACTCCTCATTGTACCTATCCTAATCGCCATAGCATTCCTA
ATGCTAACCGAACGAAAAATTTTAGGCTATATACAACTACGTAAAGGCCCCAACGTC
Note that each sequence is preceded by an identifier ("human", "chimpanzee", and "gorilla") and that the identifiers are on their own line and preceded by a "#." Deletions can be represented with a "-". White space is ignored, so you do not have to have the same number of nucleotides on each line.
4. Output.
SequenceViewer provides two types of output. First, SequenceViewer displays DNA sequences (see picture above) so that variable nucleotides are easy to see. Second, SequenceViewer counts the number of differences between each pair of DNA sequences and produces a matrix of differences. The picture below shows what this looks like.

In this example, there are 90 base pair differences between humans and chimpanzees, 95 differences between humans and bonobos, and 99 differences between humans and gorillas.
|